shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SH3D19-shRNA-Seq1)(CAT#: AdV-SI0276WQ)
This product is a SH3D19-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SH3D19 gene encoded protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. The expression of SH3D19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SH3D19-shRNA-Seq1 |
| Related Target/Protein | SH3D19 |
| Region | 3UTR |
| TargetSeq | GCTTGAGCATATCAGCCTTAT |
| NCBI RefSeq | NM_001009555 |
| Alternative Names | EBP; EVE1; Kryn; Eve-1; SH3P19 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Acute myeloid leukemia |