shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SPANXN3-shRNA-Seq2)(CAT#: AdV-SI0193WQ)

This product is a SPANXN3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of SPANXN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SPANXN3-shRNA-Seq2
Related Target/Protein SPANXN3
Region CDS
TargetSeq GAGGATGAAGACCTAGGCTTA
NCBI RefSeq NM_001009609
Alternative Names CT11.8; SPANX-N3
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancer
Target Gene
Gene ID 139067
Uniprot ID Q5MJ09

Related Products