shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Zfp414-shRNA-Seq1)(CAT#: AdV-SI2231WQ)

Datasheet

This product is a Zfp414-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Zfp414 gene may be involved in transcriptional regulation. The expression of Zfp414-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Zfp414-shRNA-Seq1
Related Target/Protein Zfp414
Region CDS
TargetSeq GTTCGTGATCTAGCACAGCAT
NCBI RefSeq NM_026712
Alternative Names Znf414; 0610030H11Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 328801
Uniprot ID Q9DCK4

Related Products

shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Lactb2-shRNA-Seq4) (CAT#:AdV-SI2786WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(RBM33-shRNA-Seq1) (CAT#:AdV-SI2105WQ) Recombinant adenovirus, pU6-(Rattus CCR7), Overexpression (CAT#:AdV-GTOH0089WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(YPEL3-shRNA-Seq2) (CAT#:AdV-SI1159WQ) Recombinant adenovirus, pU6-(Human MMP9), Overexpression (CAT#:AdV-GTOH0182WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TRABD-shRNA-Seq1) (CAT#:AdV-SI0749WQ) Recombinant adenovirus, pU6-(Human hsa-mir-134), Overexpression (CAT#:AdV-GTOH0309WQ) shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LRRC18-shRNA-Seq1) (CAT#:AdV-SI1208WQ)