shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Zfp414-shRNA-Seq1)(CAT#: AdV-SI2231WQ)
This product is a Zfp414-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Zfp414 gene may be involved in transcriptional regulation. The expression of Zfp414-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Zfp414-shRNA-Seq1 |
Related Target/Protein | Zfp414 |
Region | CDS |
TargetSeq | GTTCGTGATCTAGCACAGCAT |
NCBI RefSeq | NM_026712 |
Alternative Names | Znf414; 0610030H11Rik |
Titer | >1*10^10 GC/mL |