shRNA Lentivirus (self-inactivating), p7SK-(FBXL16-shRNA-Seq1)(CAT#: LV-SI3213WQ)
This product is a FBXL16-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by FBXL16 belongs to the F-box protein family and they interact with ubiquitination targets through other protein interaction domains. The expression of FBXL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | FBXL16-shRNA-Seq1 |
Related Target/Protein | FBXL16 |
Region | CDS |
TargetSeq | CCTGGACATCTGTGAGTTCAT |
NCBI RefSeq | NM_153350 |
Alternative Names | Fbl16; C16orf22; c380A1.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ductal Carcinoma |