shRNA Lentivirus (self-inactivating), p7SK-(NECAP1-shRNA-Seq3)(CAT#: LV-SI1474WQ)
This product is a NECAP1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The NECAP1 gene encodes a protein containing two characteristic WXXF motifs and the encoded protein localizes to clathrin-coated vesicles, where it binds components of the adapter protein complexes and aids in endocytosis. The expression of NECAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | NECAP1-shRNA-Seq3 |
| Related Target/Protein | NECAP1 |
| Region | CDS |
| TargetSeq | CGCAGTGCTTTCATTGGCATT |
| NCBI RefSeq | NM_015509 |
| Alternative Names | EIEE21 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Retinal Degeneration |