shRNA Lentivirus (self-inactivating), p7SK-(OR5B12-shRNA-Seq3)(CAT#: LV-SI3351WQ)

This product is a OR5B12-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR5B12 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5B12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR5B12-shRNA-Seq3
Related Target/Protein OR5B12
Region CDS
TargetSeq GACAGGAATCTTTATGTACTT
NCBI RefSeq XM_372409
Alternative Names OR5B16; OST743; OR5B12P; OR11-241
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390191
Uniprot ID Q96R08

Related Products