shRNA Lentivirus (self-inactivating), p7SK-(Prlhr-shRNA-Seq1)(CAT#: LV-SI4025WQ)

This product is a Prlhr-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Prlhr gene is a 7-transmembrane domain receptor for prolactin-releasing hormone that is highly expressed in anterior pituitary. The expression of Prlhr-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Prlhr-shRNA-Seq1
Related Target/Protein Prlhr
Region 3UTR
TargetSeq GATCTTATTCCCAGCACCAAA
NCBI RefSeq NM_201615
Alternative Names GR3; GPR10; PrRPR
Titer >1*10^10 GC/mL
Target Gene
Gene ID 2834
Uniprot ID P49683

Related Products