shRNA Lentivirus (self-inactivating), p7SK-(Prlhr-shRNA-Seq1)(CAT#: LV-SI4025WQ)
This product is a Prlhr-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Prlhr gene is a 7-transmembrane domain receptor for prolactin-releasing hormone that is highly expressed in anterior pituitary. The expression of Prlhr-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Prlhr-shRNA-Seq1 |
| Related Target/Protein | Prlhr |
| Region | 3UTR |
| TargetSeq | GATCTTATTCCCAGCACCAAA |
| NCBI RefSeq | NM_201615 |
| Alternative Names | GR3; GPR10; PrRPR |
| Titer | >1*10^10 GC/mL |
