shRNA Lentivirus (self-inactivating), pH1-(1700001C02Rik-shRNA-Seq1)(CAT#: LV-SI3156WQ)

This product is a 1700047H18Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 1700047H18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 1700001C02Rik-shRNA-Seq1
Related Target/Protein 1700001C02Rik
Region CDS
TargetSeq CTTCCTCCTTTGGCTCTTCTT
NCBI RefSeq NM_029285
Alternative Names 1700047H18Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 75434
Uniprot ID D3Z6F6

Related Products