shRNA Lentivirus (self-inactivating), pH1-(5730590G19Rik-shRNA-Seq1)(CAT#: LV-SI3150WQ)

This product is a 5730590G19Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 5730590G19Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 5730590G19Rik-shRNA-Seq1
Related Target/Protein 5730590G19Rik
Region CDS
TargetSeq CCAAAGAAGCTGAATTTCAAA
NCBI RefSeq NM_029835
Alternative Names Lrrk1; BC028450; Ticrr
Titer >1*10^10 GC/mL
Target Gene
Gene ID 77011
Uniprot ID Q8C6J3

Related Products