shRNA Lentivirus (self-inactivating), pH1-(C15orf45-shRNA-Seq3)(CAT#: LV-SI0859WQ)

This product is a C15orf45-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C15orf45-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C15orf45-shRNA-Seq3
Related Target/Protein C15orf45
Region 3UTR
TargetSeq GCTCTGTTAATTGTGCTGTTA
NCBI RefSeq NM_001035530
Titer >1*10^10 GC/mL
Related Diseases Hereditary Colorectal Cancer

Related Products