shRNA Lentivirus (self-inactivating), pH1-(C8orf4-shRNA-Seq1)(CAT#: LV-SI0562WQ)

This product is a C8orf4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C8orf4 gene encodes a small, monomeric, predominantly unstructured protein that functions as a positive regulator of the Wnt/beta-catenin signaling pathway. The expression of C8orf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C8orf4-shRNA-Seq1
Related Target/Protein C8orf4
Region CDS
TargetSeq GAGACAAGAAAGCAGAGGAGA
NCBI RefSeq NM_020130
Alternative Names TC1; TC-1; TCIM
Titer >1*10^10 GC/mL
Related Diseases Thyroid cancer, breast cancer and hematological malignancies
Target Gene
Gene ID 56892
Uniprot ID Q9NR00

Related Products