shRNA Lentivirus (self-inactivating), pH1-(Ccdc43-shRNA-Seq1)(CAT#: LV-SI3060WQ)

This product is a Ccdc43-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Ccdc43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Ccdc43-shRNA-Seq1
Related Target/Protein Ccdc43
Region CDS
TargetSeq CATCGCCACCTTGATTGAGAA
NCBI RefSeq NM_025918
Titer >1*10^10 GC/mL
Target Gene
Gene ID 124808
Uniprot ID Q96MW1

Related Products