shRNA Lentivirus (self-inactivating), pH1-(CCT3-shRNA-Seq3)(CAT#: LV-SI2954WQ)
This product is a CCT3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by CCT3 gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). The expression of CCT3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CCT3-shRNA-Seq3 |
| Related Target/Protein | CCT3 |
| Region | CDS |
| TargetSeq | GTGTAAATGGTGAGACGGGTA |
| NCBI RefSeq | NM_005998 |
| Alternative Names | CCTG; PIG48; TRIC5; CCT-gamma; TCP-1-gamma |
| Titer | >1*10^10 GC/mL |