shRNA Lentivirus (self-inactivating), pH1-(D730001G18Rik-shRNA-Seq1)(CAT#: LV-SI3199WQ)
This product is a D730001G18Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by D730001G18Rik has acetylcholine receptor inhibitor activity. The expression of D730001G18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | D730001G18Rik-shRNA-Seq1 |
Related Target/Protein | D730001G18Rik |
Region | CDS |
TargetSeq | CCTCTATGAGACCTTCAGAGT |
NCBI RefSeq | NM_172433 |
Alternative Names | Ly6g6g |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 78725 |
Uniprot ID | A0A087WQU7 |