shRNA Lentivirus (self-inactivating), pH1-(GEMIN8-shRNA-Seq2)(CAT#: LV-SI0671WQ)
This product is a GEMIN8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by GEMIN8 gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The expression of GEMIN8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | GEMIN8-shRNA-Seq2 |
| Related Target/Protein | GEMIN8 |
| Region | CDS |
| TargetSeq | CCTCAGTCCTTCTATGACCAT |
| NCBI RefSeq | NM_017856 |
| Alternative Names | FAM51A1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Survival motor neuron (SMN) |