shRNA Lentivirus (self-inactivating), pH1-(Gpatch2-shRNA-Seq4)(CAT#: LV-SI2678WQ)
This product is a Gpatch2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Gpatch2-shRNA-Seq4 |
Related Target/Protein | Gpatch2 |
Region | CDS |
TargetSeq | GCTTAAGTGAAGGCTCTGATT |
NCBI RefSeq | NM_026367 |
Alternative Names | Pfa1; CT110; GPATC2; PPP1R30 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |