shRNA Lentivirus (self-inactivating), pH1-(Gpatch2-shRNA-Seq4)(CAT#: LV-SI2678WQ)
This product is a Gpatch2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Gpatch2-shRNA-Seq4 |
| Related Target/Protein | Gpatch2 |
| Region | CDS |
| TargetSeq | GCTTAAGTGAAGGCTCTGATT |
| NCBI RefSeq | NM_026367 |
| Alternative Names | Pfa1; CT110; GPATC2; PPP1R30 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |