shRNA Lentivirus (self-inactivating), pH1-(Gpatch2-shRNA-Seq5)(CAT#: LV-SI2679WQ)

This product is a Gpatch2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Gpatch2-shRNA-Seq5
Related Target/Protein Gpatch2
Region 3UTR
TargetSeq CGCCAGTGATAGAAATGGGAT
NCBI RefSeq NM_026367
Alternative Names Pfa1; CT110; GPATC2; PPP1R30
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 55105
Uniprot ID Q9NW75

Related Products