shRNA Lentivirus (self-inactivating), pH1-(KIAA0930-shRNA-Seq1)(CAT#: LV-SI0976WQ)

This product is a KIAA0930-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of KIAA0930-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert KIAA0930-shRNA-Seq1
Related Target/Protein KIAA0930
Region CDS
TargetSeq CGTCTTCTGGACTTGGATGTT
NCBI RefSeq NM_015264
Alternative Names LSC3; C22orf9
Titer >1*10^10 GC/mL
Related Diseases Melanoma
Target Gene
Gene ID 23313
Uniprot ID Q6ICG6

Related Products