shRNA Lentivirus (self-inactivating), pH1-(KLHL7-shRNA-Seq2)(CAT#: LV-SI0564WQ)
This product is a KLHL7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The KLHL7 encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. The expression of KLHL7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | KLHL7-shRNA-Seq2 |
Related Target/Protein | KLHL7 |
Region | CDS |
TargetSeq | GAACTGAAAGCTGGCACACAA |
NCBI RefSeq | NM_018846 |
Alternative Names | CISS3; KLHL6; SBBI26 |
Titer | >1*10^10 GC/mL |
Related Diseases | Retinitis pigmentosa |