shRNA Lentivirus (self-inactivating), pH1-(Mrpl14-shRNA-Seq1)(CAT#: LV-SI3192WQ)

This product is a Mrpl14-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Mrpl14 gene encodes a protein component of the 39S subunit of the mitochondrial ribosome. The expression of Mrpl14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Mrpl14-shRNA-Seq1
Related Target/Protein Mrpl14
Region CDS
TargetSeq CCTCATTGAGGACAATGGCAA
NCBI RefSeq NM_026732
Alternative Names L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32
Titer >1*10^10 GC/mL
Target Gene
Gene ID 64928
Uniprot ID Q6P1L8

Related Products