shRNA Lentivirus (self-inactivating), pH1-(Ola1-shRNA-Seq2)(CAT#: LV-SI2586WQ)
This product is a Ola1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Ola1-shRNA-Seq2 |
| Related Target/Protein | Ola1 |
| Region | CDS |
| TargetSeq | GCTGAAGTAATGAAGTATGAA |
| NCBI RefSeq | NM_025942 |
| Alternative Names | DOC45; GBP45; GTBP9; GTPBP9; PTD004 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |