shRNA Lentivirus (self-inactivating), pH1-(Olfr1089-shRNA-Seq2)(CAT#: LV-SI2894WQ)

This product is a Olfr1089-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr1089 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1089-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr1089-shRNA-Seq2
Related Target/Protein Olfr1089
Region CDS
TargetSeq GCTTTACAGCTAGCTTGCTTT
NCBI RefSeq NM_001011771
Alternative Names MOR193-1
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 257933
Uniprot ID A0A1L1SRK6

Related Products