shRNA Lentivirus (self-inactivating), pH1-(OR6C4-shRNA-Seq2)(CAT#: LV-SI2397WQ)

This product is a OR6C4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR6C4 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR6C4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR6C4-shRNA-Seq2
Related Target/Protein OR6C4
Region CDS
TargetSeq CCAAGTGATGATATTCATCTT
NCBI RefSeq XM_292051
Alternative Names OR12-10
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 341418
Uniprot ID Q8NGE1

Related Products