shRNA Lentivirus (self-inactivating), pH1-(PIGX-shRNA-Seq1)(CAT#: LV-SI2897WQ)
This product is a PIGX-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PIGX gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER) and the protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I. The expression of PIGX-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PIGX-shRNA-Seq1 |
| Related Target/Protein | PIGX |
| Region | CDS |
| TargetSeq | GAAGCCTCGATTGTGGTCAAT |
| NCBI RefSeq | NM_017861 |
| Alternative Names | PIG-X |
| Titer | >1*10^10 GC/mL |
