shRNA Lentivirus (self-inactivating), pH1-(RNPS1-shRNA-Seq4)(CAT#: LV-SI0553WQ)
This product is a RNPS1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RNPS1 gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The expression of RNPS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | RNPS1-shRNA-Seq4 |
| Related Target/Protein | RNPS1 |
| Region | CDS |
| TargetSeq | CAGCTCCAACTCCTCCCGATA |
| NCBI RefSeq | NM_006711 |
| Alternative Names | E5.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neuro-developmental disorders |