shRNA Lentivirus (self-inactivating), pH1-(SCAF1-shRNA-Seq1)(CAT#: LV-SI0779WQ)

This product is a SCAF1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SCAF1 may function in pre-mRNA splicing. The expression of SCAF1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SCAF1-shRNA-Seq1
Related Target/Protein SCAF1
Region CDS
TargetSeq CCCAATGATAAAGATGGCTCT
NCBI RefSeq NM_021228
Alternative Names SRA1
Titer >1*10^10 GC/mL
Related Diseases Atherosclerosis
Target Gene
Gene ID 58506
Uniprot ID Q9H7N4

Related Products