shRNA Lentivirus (self-inactivating), pH1-(SPANXN4-shRNA-Seq2)(CAT#: LV-SI0852WQ)
This product is a SPANXN4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPANXN4 gene represents one of several duplicated family members that are located on the X chromosome. The expression of SPANXN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SPANXN4-shRNA-Seq2 |
| Related Target/Protein | SPANXN4 |
| Region | CDS |
| TargetSeq | CTGAACAGAGTTTGAAAGAGA |
| NCBI RefSeq | NM_001009613 |
| Alternative Names | CT11.9 |
| Titer | >1*10^10 GC/mL |