shRNA Lentivirus (self-inactivating), pH1-(Tcte1-shRNA-Seq3)(CAT#: LV-SI2749WQ)

This product is a Tcte1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Tcte1-shRNA-Seq3
Related Target/Protein Tcte1
Region 3UTR
TargetSeq GCTGACTAATTCAAACTCTTA
NCBI RefSeq NM_013688
Alternative Names DRC5; D6S46; FAP155
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 202500
Uniprot ID Q5JU00

Related Products