shRNA Lentivirus (self-inactivating), pH1-(Tha1-shRNA-Seq1)(CAT#: LV-SI3089WQ)
This product is a Tha1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tha1 gene has L-allo-threonine aldolase activity. The expression of Tha1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Tha1-shRNA-Seq1 |
| Related Target/Protein | Tha1 |
| Region | 3UTR |
| TargetSeq | CTGGAGGATGGTGACATCATT |
| NCBI RefSeq | NM_027919 |
| Alternative Names | GLY1; 1300017K07Rik |
| Titer | >1*10^10 GC/mL |
