shRNA Lentivirus (self-inactivating), pH1-(TMEM44-shRNA-Seq1)(CAT#: LV-SI0966WQ)

This product is a TMEM44-shRNA encoding Lentivirus, which is based on HIV-1 serotype. TMEM44 gene encodes a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. The expression of TMEM44-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TMEM44-shRNA-Seq1
Related Target/Protein TMEM44
Region CDS
TargetSeq CGCTGCTTCTCTATCTGAGAT
NCBI RefSeq NM_138399
Titer >1*10^10 GC/mL
Target Gene
Gene ID 93109
Uniprot ID Q2T9K0

Related Products