shRNA Lentivirus (self-inactivating), pH1-(TREH-shRNA-Seq1)(CAT#: LV-SI0870WQ)

This product is a TREH-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TREH gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. The expression of TREH-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TREH-shRNA-Seq1
Related Target/Protein TREH
Region CDS
TargetSeq GAATCGCTATTATGTCCCTTA
NCBI RefSeq NM_007180
Alternative Names TRE; TREA; TREHD
Titer >1*10^10 GC/mL
Related Diseases Motoneuron degeneration
Target Gene
Gene ID 11181
Uniprot ID O43280

Related Products