shRNA Lentivirus (self-inactivating), pH1-(VARS2-shRNA-Seq3)(CAT#: LV-SI2385WQ)
This product is a VARS2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The VARS2 encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. The expression of VARS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | VARS2-shRNA-Seq3 |
| Related Target/Protein | VARS2 |
| Region | 3UTR |
| TargetSeq | GTCTTTGAGGACAAACAGATT |
| NCBI RefSeq | NM_020442 |
| Alternative Names | VALRS; VARSL; VARS2L; COXPD20 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | oxidative phosphorylation deficiency-20 |