shRNA Lentivirus (self-inactivating), pH1-(ZDHHC3-shRNA-Seq1)(CAT#: LV-SI0968WQ)
This product is a ZDHHC3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZDHHC3 Tyrosine Phosphorylation Regulates Neural Cell Adhesion Molecule Palmitoylation. The expression of ZDHHC3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | ZDHHC3-shRNA-Seq1 |
Related Target/Protein | ZDHHC3 |
Region | CDS |
TargetSeq | CGAAACATTGAGCGGAAACCA |
NCBI RefSeq | NM_016598 |
Alternative Names | GODZ; DHHC3; DHHC-3; ZNF373 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast Cancer |