shRNA Lentivirus (self-inactivating), pU6-(4933405O20Rik-shRNA-Seq1)(CAT#: LV-SI2217WQ)
This product is a 4933405O20Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by 4933405O20Rik gene is regulatory subunit which plays a role in the allosteric regulation of the enzyme catalyzing the decarboxylation of isocitrate (ICT) into alpha-ketoglutarate. The expression of 4933405O20Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | 4933405O20Rik-shRNA-Seq1 |
| Related Target/Protein | 4933405O20Rik |
| Region | CDS |
| TargetSeq | CTTCACCAAAGTATGGAGGAA |
| NCBI RefSeq | NM_172901 |
| Titer | >1*10^10 GC/mL |