shRNA Lentivirus (self-inactivating), pU6-(9330154K18Rik-shRNA-Seq1)(CAT#: LV-SI2338WQ)

This product is a 9330154K18Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 9330154K18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 9330154K18Rik-shRNA-Seq1
Related Target/Protein 9330154K18Rik
Region CDS
TargetSeq GTCATCCTGGGATACATTCAT
NCBI RefSeq NM_177011
Titer >1*10^10 GC/mL
Target Gene
Gene ID 319829
Uniprot ID Q8CC20

Related Products