shRNA Lentivirus (self-inactivating), pU6-(BTBD9-shRNA-Seq2)(CAT#: LV-SI0414WQ)

This product is a BTBD9-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BTBD9 gene encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. The expression of BTBD9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert BTBD9-shRNA-Seq2
Related Target/Protein BTBD9
Region CDS
TargetSeq CAGCCTTATTAGATGGTGATA
NCBI RefSeq NM_152733
Alternative Names dJ322I12.1
Titer >1*10^10 GC/mL
Related Diseases Tourette Syndrome
Target Gene
Gene ID 114781
Uniprot ID Q96Q07

Related Products