shRNA Lentivirus (self-inactivating), pU6-(CDCA3-shRNA-Seq2)(CAT#: LV-SI0123WQ)

This product is a CDCA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. CDCA3 is a potential prognostic marker that promotes cell proliferation in gastric cancer. CDCA3 overexpression resulted in the stimulation of cell growth and colony formation in vitro and xenograft tumors in vivo. Conversely, knockdown of CDCA3 inhibited these effects. The expression of CDCA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CDCA3-shRNA-Seq2
Related Target/Protein CDCA3
Region 3UTR
TargetSeq GATACTGAGGAATGGCTTGTT
NCBI RefSeq NM_031299
Alternative Names GRCC8; TOME-1
Titer >1*10^10 GC/mL
Related Diseases Gastric cancer
Target Gene
Gene ID 83461
Uniprot ID Q99618

Related Products