shRNA Lentivirus (self-inactivating), pU6-(Chchd7-shRNA-Seq1)(CAT#: LV-SI2241WQ)

This product is a Chchd7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Chchd7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Chchd7-shRNA-Seq1
Related Target/Protein Chchd7
Region CDS
TargetSeq CAGTTACTTCTTGAAGTACAA
NCBI RefSeq NM_181391
Alternative Names COX23
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79145
Uniprot ID Q9BUK0

Related Products