shRNA Lentivirus (self-inactivating), pU6-(Cyb5d2-shRNA-Seq3)(CAT#: LV-SI2038WQ)
This product is a Cyb5d2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Cyb5d2-shRNA-Seq3 |
| Related Target/Protein | Cyb5d2 |
| Region | CDS |
| TargetSeq | GTGACAGGAGACTATTCTGAA |
| NCBI RefSeq | XM_109819 |
| Alternative Names | CYB5D2 |
| Titer | >1*10^10 GC/mL |