shRNA Lentivirus (self-inactivating), pU6-(DEPDC1-shRNA-Seq3)(CAT#: LV-SI0066WQ)
This product is a DEPDC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The DEPDC1 gene may be involved in transcriptional regulation as a transcriptional corepressor. The expression of DEPDC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | DEPDC1-shRNA-Seq3 |
Related Target/Protein | DEPDC1 |
Region | 3UTR |
TargetSeq | CCCACTGAAATCAGGGCATAT |
NCBI RefSeq | NM_017779 |
Alternative Names | DEP.8; SDP35; DEPDC1A; DEPDC1-V2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Bladder cancer |