shRNA Lentivirus (self-inactivating), pU6-(Dos-shRNA-Seq1)(CAT#: LV-SI2294WQ)
This product is a Dos-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Dos gene negatively regulates voltage-gated calcium channels by preventing the interaction between their alpha and beta subunits. The expression of Dos-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Dos-shRNA-Seq1 |
| Related Target/Protein | Dos |
| Region | CDS |
| TargetSeq | GCCGACTTCATTCAGTACATT |
| NCBI RefSeq | NM_015761 |
| Alternative Names | DOS; BARP; C19orf26; CBARP |
| Titer | >1*10^10 GC/mL |