shRNA Lentivirus (self-inactivating), pU6-(Ktn1-shRNA-Seq5)(CAT#: LV-SI1749WQ)
This product is a Ktn1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ktn1 gene encodes an integral membrane protein that is a member of the kinectin protein family. The expression of Ktn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Ktn1-shRNA-Seq5 |
| Related Target/Protein | Ktn1 |
| Region | CDS |
| TargetSeq | GCAGAAACTTCCAGTAGTGTT |
| NCBI RefSeq | NM_008477 |
| Alternative Names | CG1; KNT; MU-RMS-40.19 |
| Titer | >1*10^10 GC/mL |