shRNA Lentivirus (self-inactivating), pU6-(Lactb2-shRNA-Seq1)(CAT#: LV-SI1933WQ)

This product is a Lactb2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lactb2 gene is required for normal mitochondrial function and cell viability. The expression of Lactb2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lactb2-shRNA-Seq1
Related Target/Protein Lactb2
Region 3UTR
TargetSeq GAACAATTCAAACCAGTTAAT
NCBI RefSeq NM_145381
Alternative Names CGI-83
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51110
Uniprot ID Q53H82

Related Products