shRNA Lentivirus (self-inactivating), pU6-(Lrrtm3-shRNA-Seq1)(CAT#: LV-SI2331WQ)

This product is a Lrrtm3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lrrtm3 gene may play a role in the development and maintenance of the vertebrate nervous system. The expression of Lrrtm3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lrrtm3-shRNA-Seq1
Related Target/Protein Lrrtm3
Region CDS
TargetSeq CTCTCCCATAAGTCCTTTGAA
NCBI RefSeq NM_178678
Titer >1*10^10 GC/mL
Related Diseases Vertebrate nervous system disease
Target Gene
Gene ID 347731
Uniprot ID Q86VH5

Related Products