shRNA Lentivirus (self-inactivating), pU6-(MORC2-shRNA-Seq1)(CAT#: LV-SI0375WQ)
This product is a MORC2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MORC2 gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The expression of MORC2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | MORC2-shRNA-Seq1 |
| Related Target/Protein | MORC2 |
| Region | CDS |
| TargetSeq | CATCTATAAGTACTCTCCATT |
| NCBI RefSeq | NM_014941 |
| Alternative Names | ZCW3; CMT2Z; ZCWCC1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |