shRNA Lentivirus (self-inactivating), pU6-(NECAP1-shRNA-Seq2)(CAT#: LV-SI0471WQ)

This product is a NECAP1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The NECAP1 gene encodes a protein containing two characteristic WXXF motifs and the encoded protein localizes to clathrin-coated vesicles, where it binds components of the adapter protein complexes and aids in endocytosis. The expression of NECAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert NECAP1-shRNA-Seq2
Related Target/Protein NECAP1
Region CDS
TargetSeq CTTCGACTTTAATGTCTCCTT
NCBI RefSeq NM_015509
Alternative Names EIEE21
Titer >1*10^10 GC/mL
Related Diseases Retinal Degeneration
Target Gene
Gene ID 25977
Uniprot ID Q9CR95

Related Products