shRNA Lentivirus (self-inactivating), pU6-(OR2V2-shRNA-Seq3)(CAT#: LV-SI1646WQ)

This product is a OR2V2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR2V2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR2V2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR2V2-shRNA-Seq3
Related Target/Protein OR2V2
Region CDS
TargetSeq CCTCCTCATCTTCCTCATCTA
NCBI RefSeq XM_210637
Alternative Names OR2V3; OST713
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 285659
Uniprot ID Q96R30

Related Products