shRNA Lentivirus (self-inactivating), pU6-(Pomp-shRNA-Seq3)(CAT#: LV-SI1727WQ)
This product is a Pomp-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Pomp gene is a molecular chaperone that binds 20S preproteasome components and is essential for 20S proteasome formation. The expression of Pomp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Pomp-shRNA-Seq3 |
Related Target/Protein | Pomp |
Region | 3UTR |
TargetSeq | GCAGTAAAGTACAGAGAGGAT |
NCBI RefSeq | NM_025624 |
Alternative Names | UMP1; PRAAS2; HSPC014; C13orf12; PNAS-110 |
Titer | >1*10^10 GC/mL |
Related Diseases | KLICK syndrome |