shRNA Lentivirus (self-inactivating), pU6-(Pramel1-shRNA-Seq1)(CAT#: LV-SI2299WQ)
This product is a Pramel1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pramel1 gene may play a role in acrosome development and also in sperm maturation and motility. The expression of Pramel1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Pramel1-shRNA-Seq1 |
Related Target/Protein | Pramel1 |
Region | CDS |
TargetSeq | CTACAGGAGAATCTTAGAGAT |
NCBI RefSeq | NM_031377 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |