shRNA Lentivirus (self-inactivating), pU6-(RTBDN-shRNA-Seq1)(CAT#: LV-SI0373WQ)
This product is a RTBDN-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by RTBDN gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. The expression of RTBDN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | RTBDN-shRNA-Seq1 |
Related Target/Protein | RTBDN |
Region | CDS |
TargetSeq | CCTTACCTATGGACAGACCTT |
NCBI RefSeq | NM_031429 |
Titer | >1*10^10 GC/mL |
Related Diseases | Eye disease |